Review



prism 7000 sds software  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher prism 7000 sds software
    Prism 7000 Sds Software, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prism+7000+sds/ppr0931807-446-6-10
    Average 90 stars, based on 1 article reviews
    prism 7000 sds software - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Comparative analysis of four methods to extract DNA from paraffin-embedded tissues: effect on downstream molecular applications
    Article Snippet: Twenty-five μL of PCR, using a homebrew "JBZ" 4× mastermix, contained 20 mmol/L Tris-HCl, pH 8.4, 50 mmol/L KCl, 3 mmol/L MgCl 2 (prepared from 10× PCR buffer and 50 mmol/L MgCl 2 solution delivered with Platinum Taq polymerase), 0.75 U of Platinum Taq polymerase (Invitrogen BV, Breda, The Netherlands), 4% glycerol (molecular biology grade; Calbiochem, VWR International BV, Amsterdam, The Netherlands), 200 μmol/L of each dNTP (Invitrogen BV), 0.5 μL of Rox reference dye (Invitrogen BV), 300 nM of PhHV forward primer 5'-GGG CGA ATC ACA GAT TGA ATC-3', 300 nM of PhHV reverse primer 5'-GCG GTT CCA AAC GTA CCA A-3', 100 nM PhHV TaqMan probe 5'-FAM-TTT TTA TGT GTC CGC CAC CAT CTG GAT C-TAMRA-3' and 10 μL extracted DNA [ ]. .. Real time PCR was performed in an ABI Prism 7000 SDS (Applied Biosystems (ABI), Foster City CA, USA) for 2 minutes at 50°C, 10 minutes at 95°C, followed by 45 cycles of 15 seconds at 95°C and 1 minute at 60°C. .. Predesigned TaqMan Assays-on-Demand SNP genotyping products rs2043731 and rs1350138 (ABI) were used according to the manufacturer's instructions.

    Article Title: Psychological Stress-Induced, IDO1-Dependent Tryptophan Catabolism: Implications on Immunosuppression in Mice and Humans
    Article Snippet: Reverse transcription of mRNA was performed with the mouse MGB IDO1 primer mixture (Gene Expression Assays: Mm00492586_m1) and mouse GAPDH primers (Applied Biosystems, Foster City, CA). .. Real-time PCR was carried out in an ABI PRISM 7000 SDS (50°C, 2-min and 95°C, 10-min, 40-cycles 95°C,15-s and 60°C 1-min; Applied Biosystems). .. IDO1 mRNA was quantified by Ct method normalized to GAPDH using ABI Prism 7000 software. (GAPDH expression in control mice and acutely stressed animals was comparable, e.g. in brain IDO1-signal detectable at cycle: 17.33±1.46 in non-stressed mice, 16.83±1.73 at 2-h and 16.38±0.58 6-h after acute stress).

    Article Title: Comparative analysis of four methods to extract DNA from paraffin-embedded tissues: effect on downstream molecular applications
    Article Snippet: Twenty-five μL of PCR, using the commercial mastermix, contained 12.5 μL of 2× TaqMan Universal PCR Mastermix (ABI), 1.25 μL of predeveloped assay reagent from the Assays-on-Demand SNP genotyping products and 11.25 μL of target DNA. .. Real time PCR was performed in an ABI Prism 7000 SDS (ABI) for 2 minutes at 50°C, 10 minutes at 95°C, followed by 45 cycles of 15 seconds at 95°C and 1 minute at 60°C. .. Five μL of eluate was added to 12.5 μL of 2× Qiagen Multiplex Mastermix ® (Qiagen), 2.5 μL of primer pool (containing 2 μM of each primer) and 5 μL of ultrapure water (Gibco BRL division of Invitrogen, Gaithersburg, USA).

    Article Title: Identification of candidate genes for congenital splay leg in piglets by alternative analysis of DNA microarray data
    Article Snippet: .. Real time PCR amplification was performed for all genes under following conditions on an ABI Prism 7000 SDS (Applied Biosystems, Darmstadt, Germany): 2 min at 50 oC, 15 min at 95 °C followed by 45 cycles of 15 s at 95 oC, 30 s at T a (Table ), and 30 s at 72 oC. ..

    Article Title: Microrna-221 and Microrna-222 Modulate Differentiation and Maturation of Skeletal Muscle Cells
    Article Snippet: Total RNA was extracted using TRIzol (Invitrogen). .. RNA enriched for small RNAs was obtained using the PureLink miRNA Isolation Kit (Invitrogen), according to the manufacturer's instructions. miRNA levels were analyzed using the TaqMan Real Time PCR method (1 ng/assay), and quantified with ABI Prism 7000 SDS (Applied Biosystems). .. Primers for miRNAs and the reagents for reverse transcription and PCR reactions were all obtained from Applied Biosystems.

    Polymerase Chain Reaction:

    Article Title: Expression profiling of repetitive elements by melting temperature analysis: variation in HERV-W gag expression across human individuals and tissues
    Article Snippet: Total RNA was treated with DNase I (Invitrogen) followed by first strand cDNA synthesis using oligo-d(T) 12-18 primers and Superscript II reagents (Invitrogen) as previously described [ ]. .. Realtime PCR was run on an ABI Prism 7000 SDS (Applied Biosystems) with a Precision Plate Holder (Applied Biosystems, Foster City, CA, USA), white Thermo-Fast ® 96 Detection Plates (ABgene, Epsom, UK) and the version 1.2.3 SDS software package (Applied Biosystems). .. Platinum SYBR Green qPCR SuperMix UDG (Invitrogen) was used in each of the 25 μl reactions containing 250 nM of forward (TCAGGTCAACAATAGGATGACAACA) and reverse (CAATGAGGGTCTACACTGGGAACT) primers (Invitrogen) directed at the HERV-W gag gene and 133 nM of the Tm probe (Eurogentech, Seraing, Belgium) as previously described [ ].

    Software:

    Article Title: Expression profiling of repetitive elements by melting temperature analysis: variation in HERV-W gag expression across human individuals and tissues
    Article Snippet: Total RNA was treated with DNase I (Invitrogen) followed by first strand cDNA synthesis using oligo-d(T) 12-18 primers and Superscript II reagents (Invitrogen) as previously described [ ]. .. Realtime PCR was run on an ABI Prism 7000 SDS (Applied Biosystems) with a Precision Plate Holder (Applied Biosystems, Foster City, CA, USA), white Thermo-Fast ® 96 Detection Plates (ABgene, Epsom, UK) and the version 1.2.3 SDS software package (Applied Biosystems). .. Platinum SYBR Green qPCR SuperMix UDG (Invitrogen) was used in each of the 25 μl reactions containing 250 nM of forward (TCAGGTCAACAATAGGATGACAACA) and reverse (CAATGAGGGTCTACACTGGGAACT) primers (Invitrogen) directed at the HERV-W gag gene and 133 nM of the Tm probe (Eurogentech, Seraing, Belgium) as previously described [ ].

    Amplification:

    Article Title: Identification of candidate genes for congenital splay leg in piglets by alternative analysis of DNA microarray data
    Article Snippet: .. Real time PCR amplification was performed for all genes under following conditions on an ABI Prism 7000 SDS (Applied Biosystems, Darmstadt, Germany): 2 min at 50 oC, 15 min at 95 °C followed by 45 cycles of 15 s at 95 oC, 30 s at T a (Table ), and 30 s at 72 oC. ..

    Isolation:

    Article Title: Microrna-221 and Microrna-222 Modulate Differentiation and Maturation of Skeletal Muscle Cells
    Article Snippet: Total RNA was extracted using TRIzol (Invitrogen). .. RNA enriched for small RNAs was obtained using the PureLink miRNA Isolation Kit (Invitrogen), according to the manufacturer's instructions. miRNA levels were analyzed using the TaqMan Real Time PCR method (1 ng/assay), and quantified with ABI Prism 7000 SDS (Applied Biosystems). .. Primers for miRNAs and the reagents for reverse transcription and PCR reactions were all obtained from Applied Biosystems.

    Expressing:

    Article Title: Cold- and light-induced changes in the transcriptome of wheat leading to phase transition from vegetative to reproductive growth
    Article Snippet: .. To confirm expression patterns observed from the analysis of array data, real time qRT-PCR experiments were performed using an ABI Prism 7000 SDS (Applied Biosystems, U.K.). .. Reverse transcription was performed using Superscript III First Strand Synthesis Kits (Invitrogen) according to manufacturer's instructions.

    Quantitative RT-PCR:

    Article Title: Cold- and light-induced changes in the transcriptome of wheat leading to phase transition from vegetative to reproductive growth
    Article Snippet: .. To confirm expression patterns observed from the analysis of array data, real time qRT-PCR experiments were performed using an ABI Prism 7000 SDS (Applied Biosystems, U.K.). .. Reverse transcription was performed using Superscript III First Strand Synthesis Kits (Invitrogen) according to manufacturer's instructions.



    Similar Products

    90
    Thermo Fisher prism 7000 sds software
    Prism 7000 Sds Software, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prism+7000+sds/ppr0931807-446-6-10
    Average 90 stars, based on 1 article reviews
    prism 7000 sds software - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher prism™ 7000 sds
    Prism™ 7000 Sds, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prism+7000+sds/pm39358558-60-19-23
    Average 90 stars, based on 1 article reviews
    prism™ 7000 sds - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher prism 7000 sds software (v2.0.5
    Prism 7000 Sds Software (V2.0.5, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prism+7000+sds/pmc11387396-265-6-5
    Average 90 stars, based on 1 article reviews
    prism 7000 sds software (v2.0.5 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher abi-prism 7000 sds software
    Abi Prism 7000 Sds Software, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prism+7000+sds/pm38607914-250-9-9
    Average 90 stars, based on 1 article reviews
    abi-prism 7000 sds software - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher prism 7000 sds
    Prism 7000 Sds, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prism+7000+sds/prism+7300+sds+software/pm37839019-77-7-10
    Average 90 stars, based on 1 article reviews
    prism 7000 sds - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher prism® 7000 sd rt-pcr system
    Prism® 7000 Sd Rt Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prism+7000+sds/7500+fast+real+time+pcr+system/pmc10748415-177-9-15
    Average 90 stars, based on 1 article reviews
    prism® 7000 sd rt-pcr system - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results